HCV Database
HCV sequence database
 



To our users Please note that the HCV database site is no longer funded. We try to keep the database updated and the tools running, but unfortunately, we cannot guarantee we can provide help for using this site. Data won't be manually curated either.


Common Sequence Formats

Below are examples of some of the alignment formats our web interfaces recognize. In each example, two or more sequences are displayed in the given format. To convert the format of your sequence, we provide a Format Converter tool.

IMPORTANT! Do not convert your sequence files to a ".doc" file or open them in any word processing program. Sequence formats can be corrupted by cryptic changes introduced by word-processing programs and thus cause failures of sequence analysis tools.

 

Clustal W:

CPZANT ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
U455   ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA

CPZANT AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
U455   GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT

CPZANT TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
U455   TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT

CPZANT CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
U455   TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC

CPZANT CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
U455   TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

 

FastA:

>CPZANT
ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
>U455
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

 

GCG:

cf:CPZANT Length: 250 Thu Apr 28 16:08:49 MDT 2011 Check: 751 ..
  1 ATGGGAGCGG GGGCGTCTGT TTTGAGGGGA GAGAAGCTAG ATACATGGGA
 51 AAGTATCAGG CTTCGGCCCG GTGGCAAGAA AAAGTACATG ATAAAACATC
101 TGGTTTGGGC AAGATCGGAG CTGCAGCGTT TTGCGCTCAG CTCCTCCCTT
151 CTAGAAACAT CAGAAGGTTG TGAAAAGGCT ATCCATCAAT TGAGCCCTTC
201 CATAGAAATA AGATCCCCTG AAATAATATC TTTGTTTAAC ACCATTTGTG
251 

 

GDE:

{
name "CPZANT"
sequence "
ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
"
}
{
name "U455"
sequence "
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG
"
}

 

GDEFlat:

#CPZANT
ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG

#U455
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

 

IG (IntelliGenetics):

;
CPZANT
ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
;
U455
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

 

Mase:

;
CPZANT
ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG

;
U455
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

 

Mega (Interleaved):

#MEGA
TITLE: Interleaved sequence data

#CPZANT ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
#U455   ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA

#CPZANT AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
#U455   GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT

#CPZANT TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
#U455   TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT

#CPZANT CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
#U455   TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC

#CPZANT CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
#U455   TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

 

Mega (Sequential):

#MEGA
TITLE: Noninterleaved sequence data

#CPZANT
ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG

#U455
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

 

MSF:

            1                                                   50
CPZANT      ATGGGAGCGG GGGCGTCTGT TTTGAGGGGA GAGAAGCTAG ATACATGGGA
U455        ATGGGTGCGA GAGCGTCAGT ATTAAGCGGG AAAAAATTAG ATTCATGGGA
BZ126B      ATGGGTGCGA GAGCGTCAGT ATTAAGCGGG GGAAAATTAG ATGCTTGGGA
IBNG        ATGGGTGCGA GAGCGTCAGT ATTAAGTGGG GGAAAATTAG ATGCATGGGA
VI59        ATAGGTGCGA GAGCGTCAGT ATTAAGCGAG GGAAAATTAG ATGCATAGGA
VI310       ATGGGTGCGA GAGCGTCAGT ATTAAGCGGG GGAAAATTAG ATAAGTGGGA
SF2         ATGGGTGCGA GAGCGTCGGT ATTAAGCGGG GGAGAATTAG ATAAATGGGA
BZ167       ATGGGTGCGA GAGCGTCGGT ATTAAGCGGG GGAGAATTAG ATAGGTGGGA
PH153       ATGGGTGCGA GAGCGTCAGT ATTAAGCGGG GGGAAATTAG ATAGATGGGA
PH136       ATGGGTGCGA GAGCGTCAGT ATTAAGCGGG GGAGAATTAG ACAGATGGGA
TB132       ATGGGTGCGA GAGCGTCAGT ATTAAGCGGG GGACAATTAG ATAGATGGAA

 

Nexus (interleaved):

#NEXUS

begin taxa;
dimensions ntax=2;
taxlabels
CPZANT
U455
;
end;

begin characters;
dimensions nchar=250;
format interleave datatype=DNA gap=-;
matrix
CPZANT ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
U455   ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA

CPZANT AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
U455   GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT

CPZANT TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
U455   TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT

CPZANT CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
U455   TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC

CPZANT CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
U455   TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

;
end;

 

Nexus (Sequential):

#NEXUS

begin taxa;
dimensions ntax=2;
taxlabels
CPZANT
U455
;
end;

begin characters;
dimensions nchar=250;
format datatype=dna gap=-;
matrix
CPZANT ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGAAAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATCTGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTTCTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTCCATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
U455   ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGAGAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATTTAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTTTTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGCTCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG
;
end;

 

PHYLIP (Interleaved):

2  250  i



CPZANT    ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA 
U455      ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA 

          AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC 
          GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT 

          TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT 
          TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT 

          CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC 
          TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC 

          CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG 
          TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG 

 

PHYLIP (Sequential):

2  247  s

CPZANT    
ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTT

U455      
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAG

 

PIR:

>DL;CPZANT
CPZANT
ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
*
>DL;U455
U455
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG
*

 

Pretty Print:

CPZANT ATGGGAGCGG GGGCGTCTGT TTTGAGGGGA GAGAAGCTAG ATACATGGGA  50
  U455 ATGGGTGCGA GAGCGTCAGT ATTAAGCGGG AAAAAATTAG ATTCATGGGA

CPZANT AAGTATCAGG CTTCGGCCCG GTGGCAAGAA AAAGTACATG ATAAAACATC  100
  U455 GAAAATTCGG TTAAGGCCAG GGGGAAACAA AAAATATAGA CTGAAACATT

CPZANT TGGTTTGGGC AAGATCGGAG CTGCAGCGTT TTGCGCTCAG CTCCTCCCTT  150
  U455 TAGTATGGGC AAGCAGGGAG CTGGAAAAAT TCACACTTAA CCCTGGCCTT

CPZANT CTAGAAACAT CAGAAGGTTG TGAAAAGGCT ATCCATCAAT TGAGCCCTTC  200
  U455 TTAGAAACAG CAGAAGGATG TCAGCAAATA CTGGGACAAT TACAACCAGC

CPZANT CATAGAAATA AGATCCCCTG AAATAATATC TTTGTTTAAC ACCATTTGTG  250
  U455 TCTCCAGACA GGAACAGAAG AACTTAGATC ATTATATAAT ACAGTAGCAG

 

Raw:

ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG

ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

 

RSF:

!!RICH_SEQUENCE 1.0
..
{
name CPZANT
sequence
ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG

}
{
name U455
sequence
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA
GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT
TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT
TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC
TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

}

 

SLX:

CPZANT ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
U455   ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA

CPZANT AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
U455   GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT

CPZANT TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
U455   TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT

CPZANT CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
U455   TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC

CPZANT CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
U455   TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

 

Stockholm:

# STOCKHOLM 1.0

CPZANT ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA
U455   ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA

CPZANT AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC
U455   GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT

CPZANT TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT
U455   TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT

CPZANT CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC
U455   TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC

CPZANT CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG
U455   TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG

//

 

Table:

CPZANT	ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGAAAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGAT
U455	ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGAGAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACT

 

 




Questions or comments? Contact us at hcv-info@lanl.gov